circad | circRNAs associated with diseases

Hsa_circ_0005379
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Oral Squamous Cell Carcinoma	ICD-10	Carcinoma in situ of oral cavity, oesophagus and stomach (D00)
DBLink		PMID	31035951
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Patient tissues and cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCCCATACCTTTATCCACTC Reverse GTCAACATTCCAGTCTCTTCCT	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Su, W, Wang, Y, Wang, F, Sun, S, Li, M, Shen, Y, Yang, H (2019). Hsa_circ_0005379 regulates malignant behavior of oral squamous cell carcinoma through the EGFR pathway. BMC Cancer, 19, 1:400.